mouse rab27a Search Results


anti rab27a  (R&D Systems)
90
R&D Systems anti rab27a
Anti Rab27a, supplied by R&D Systems, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+rab27a/Human%2FMouse%2FRat+Rab27a+Antibody/pmc06037695-267-84-85
Average 90 stars, based on 1 article reviews
anti rab27a - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
rab27a mouse shrna  (OriGene)
91
OriGene rab27a mouse shrna
Rab27a Mouse Shrna, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+rab27a/Rab27a+Mouse+shRNA+Plasmid/bio_rxiv__2023__03__13__532413-236-5-14
Average 91 stars, based on 1 article reviews
rab27a mouse shrna - by Bioz Stars, 2026-11
91/100 stars
  Buy from Supplier
anti rab27  (OriGene)
91
OriGene anti rab27
Anti Rab27, supplied by OriGene, used in various techniques. Bioz Stars score: 91/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+rab27a/RAB27A+%2F+RAB27+Mouse+Monoclonal+Antibody/bio_rxiv__2023__02__11__528148-251-25-50
Average 91 stars, based on 1 article reviews
anti rab27 - by Bioz Stars, 2026-11
91/100 stars
  Buy from Supplier
caccgattcaagtggttgttaagga 30 sequence targeting mouse mlh1 gene  (Addgene inc)
85
Addgene inc caccgattcaagtggttgttaagga 30 sequence targeting mouse mlh1 gene
Figure 2. T cells expressing Rag1/2 and Dntt increase in <t>Mlh1-ko</t> 4T1 tumors. A–H, Representative input (left) and output (right) images and quantitative analyses of pgH2AX (A and B), CD3 (C and D), Rag1/Rag2 (E and F), and Dntt (G and H) to assess the differences between WT and Mlh1/ mice in the 4T1 model (n ¼ 4 mice/group). Original magnification, 630. Scale bar, 25 mm. I–L, Comparative images and quantitative analyses of mRNA in situ hybridization for Rag1/Rag2 and IHC for CD3 (I and J) or CD8 (K and L), assessing the percentage of CD3þ or CD8þ cells expressing Rag1/2 in WT and Mlh1/ 4T1 tumors (n ¼ 5 mice/group). Original magnification, 630. Scale bar, 25 mm. M–P, Comparative images and quantitative analyses of mRNA in situ hybridization for Dntt and IHC for CD3 (M and N) or CD8 (O and P) showing the percentage of CD3þ or CD8þ T cells expressing Dntt in WT and Mlh1/ 4T1 tumors (n ¼ 5 mice/group). Original magnification, 630. Scale bar, 25 mm. Statistical analysis: two-tailed unpaired Student t test (B, D, F, H, J, L, N, and P). Mean standard error shown; , P < 0.05; , P < 0.01; , P < 0.001; , P < 0.0001.
Caccgattcaagtggttgttaagga 30 Sequence Targeting Mouse Mlh1 Gene, supplied by Addgene inc, used in various techniques. Bioz Stars score: 85/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+rab27a/pSpCas9(BB)-2A-GFP+mouse+Rab27a+guide+1+(Plasmid+%23130656)/10__1158_slash_2326___6066__cir___20___0645-61-1-12
Average 85 stars, based on 1 article reviews
caccgattcaagtggttgttaagga 30 sequence targeting mouse mlh1 gene - by Bioz Stars, 2026-11
85/100 stars
  Buy from Supplier
anti-rab27a mab 20.1  (Becton Dickinson)
90
Becton Dickinson anti-rab27a mab 20.1
Figure 2. T cells expressing Rag1/2 and Dntt increase in <t>Mlh1-ko</t> 4T1 tumors. A–H, Representative input (left) and output (right) images and quantitative analyses of pgH2AX (A and B), CD3 (C and D), Rag1/Rag2 (E and F), and Dntt (G and H) to assess the differences between WT and Mlh1/ mice in the 4T1 model (n ¼ 4 mice/group). Original magnification, 630. Scale bar, 25 mm. I–L, Comparative images and quantitative analyses of mRNA in situ hybridization for Rag1/Rag2 and IHC for CD3 (I and J) or CD8 (K and L), assessing the percentage of CD3þ or CD8þ cells expressing Rag1/2 in WT and Mlh1/ 4T1 tumors (n ¼ 5 mice/group). Original magnification, 630. Scale bar, 25 mm. M–P, Comparative images and quantitative analyses of mRNA in situ hybridization for Dntt and IHC for CD3 (M and N) or CD8 (O and P) showing the percentage of CD3þ or CD8þ T cells expressing Dntt in WT and Mlh1/ 4T1 tumors (n ¼ 5 mice/group). Original magnification, 630. Scale bar, 25 mm. Statistical analysis: two-tailed unpaired Student t test (B, D, F, H, J, L, N, and P). Mean standard error shown; , P < 0.05; , P < 0.01; , P < 0.001; , P < 0.0001.
Anti Rab27a Mab 20.1, supplied by Becton Dickinson, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+rab27a/mouse+monoclonal+antibody+specific+rab27a/10__1172_slash_jci75572-231-3-17
Average 90 stars, based on 1 article reviews
anti-rab27a mab 20.1 - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
nm 023635  (OriGene)
90
OriGene nm 023635
Figure 2. T cells expressing Rag1/2 and Dntt increase in <t>Mlh1-ko</t> 4T1 tumors. A–H, Representative input (left) and output (right) images and quantitative analyses of pgH2AX (A and B), CD3 (C and D), Rag1/Rag2 (E and F), and Dntt (G and H) to assess the differences between WT and Mlh1/ mice in the 4T1 model (n ¼ 4 mice/group). Original magnification, 630. Scale bar, 25 mm. I–L, Comparative images and quantitative analyses of mRNA in situ hybridization for Rag1/Rag2 and IHC for CD3 (I and J) or CD8 (K and L), assessing the percentage of CD3þ or CD8þ cells expressing Rag1/2 in WT and Mlh1/ 4T1 tumors (n ¼ 5 mice/group). Original magnification, 630. Scale bar, 25 mm. M–P, Comparative images and quantitative analyses of mRNA in situ hybridization for Dntt and IHC for CD3 (M and N) or CD8 (O and P) showing the percentage of CD3þ or CD8þ T cells expressing Dntt in WT and Mlh1/ 4T1 tumors (n ¼ 5 mice/group). Original magnification, 630. Scale bar, 25 mm. Statistical analysis: two-tailed unpaired Student t test (B, D, F, H, J, L, N, and P). Mean standard error shown; , P < 0.05; , P < 0.01; , P < 0.001; , P < 0.0001.
Nm 023635, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/mouse+rab27a/Rab27a+(NM_023635)+Mouse+Tagged+ORF+Clone/pm35137580-204-17-26
Average 90 stars, based on 1 article reviews
nm 023635 - by Bioz Stars, 2026-11
90/100 stars
  Buy from Supplier
rab27a nm 023635 mouse tagged orf clone  (OriGene)
N/A
Rab27a Myc DDK tagged Mouse RAB27A member RAS oncogene family Rab27a
   Buy from Supplier
rab27a bc008173 mouse untagged clone  (OriGene)
N/A
Rab27a untagged Mouse RAB27A member RAS oncogene family cDNA clone MGC 11677 IMAGE 3710213 10ug
   Buy from Supplier
mouse monoclonal antibody to rab27a  (Angio-Proteomie)
N/A
   Buy from Supplier
rab27a mouse shrna lentiviral particle  (OriGene)
N/A
Rab27a Mouse shRNA lentiviral particles 4 unique 29mer target specific shRNA 1 scramble control 0 5 ml each 10 7 TU ml
   Buy from Supplier
rab27a nm 023635 mouse recombinant protein  (OriGene)
N/A
Purified recombinant protein of Mouse RAB27A member RAS oncogene family Rab27a with C terminal MYC DDK tag expressed in HEK293T cells 20ug
   Buy from Supplier

Image Search Results


Figure 2. T cells expressing Rag1/2 and Dntt increase in Mlh1-ko 4T1 tumors. A–H, Representative input (left) and output (right) images and quantitative analyses of pgH2AX (A and B), CD3 (C and D), Rag1/Rag2 (E and F), and Dntt (G and H) to assess the differences between WT and Mlh1/ mice in the 4T1 model (n ¼ 4 mice/group). Original magnification, 630. Scale bar, 25 mm. I–L, Comparative images and quantitative analyses of mRNA in situ hybridization for Rag1/Rag2 and IHC for CD3 (I and J) or CD8 (K and L), assessing the percentage of CD3þ or CD8þ cells expressing Rag1/2 in WT and Mlh1/ 4T1 tumors (n ¼ 5 mice/group). Original magnification, 630. Scale bar, 25 mm. M–P, Comparative images and quantitative analyses of mRNA in situ hybridization for Dntt and IHC for CD3 (M and N) or CD8 (O and P) showing the percentage of CD3þ or CD8þ T cells expressing Dntt in WT and Mlh1/ 4T1 tumors (n ¼ 5 mice/group). Original magnification, 630. Scale bar, 25 mm. Statistical analysis: two-tailed unpaired Student t test (B, D, F, H, J, L, N, and P). Mean standard error shown; , P < 0.05; , P < 0.01; , P < 0.001; , P < 0.0001.

Journal: Cancer Immunology Research

Article Title: T Cells Expressing Receptor Recombination/Revision Machinery Are Detected in the Tumor Microenvironment and Expanded in Genomically Over-unstable Models

doi: 10.1158/2326-6066.cir-20-0645

Figure Lengend Snippet: Figure 2. T cells expressing Rag1/2 and Dntt increase in Mlh1-ko 4T1 tumors. A–H, Representative input (left) and output (right) images and quantitative analyses of pgH2AX (A and B), CD3 (C and D), Rag1/Rag2 (E and F), and Dntt (G and H) to assess the differences between WT and Mlh1/ mice in the 4T1 model (n ¼ 4 mice/group). Original magnification, 630. Scale bar, 25 mm. I–L, Comparative images and quantitative analyses of mRNA in situ hybridization for Rag1/Rag2 and IHC for CD3 (I and J) or CD8 (K and L), assessing the percentage of CD3þ or CD8þ cells expressing Rag1/2 in WT and Mlh1/ 4T1 tumors (n ¼ 5 mice/group). Original magnification, 630. Scale bar, 25 mm. M–P, Comparative images and quantitative analyses of mRNA in situ hybridization for Dntt and IHC for CD3 (M and N) or CD8 (O and P) showing the percentage of CD3þ or CD8þ T cells expressing Dntt in WT and Mlh1/ 4T1 tumors (n ¼ 5 mice/group). Original magnification, 630. Scale bar, 25 mm. Statistical analysis: two-tailed unpaired Student t test (B, D, F, H, J, L, N, and P). Mean standard error shown; , P < 0.05; , P < 0.01; , P < 0.001; , P < 0.0001.

Article Snippet: The 50-CACCGATTCAAGTGGTTGTTAAGGA-30 sequence targeting mouse Mlh1 gene was cloned in pSpCas9(BB)-2A-GFP (PX458; Addgene, plasmid ID: 48138, a gift from Feng Zhang) as already described (26, 27).

Techniques: Expressing, In Situ Hybridization, Two Tailed Test